Vertex 2 TATCGGATCGGTATATCCGA Vertex 3 GCTATTCGAGCTTAAAGCTA Vertex 4 GGCTAGGTACCAGCATGCTT Link 2->3 GTATATCCGAGCTATTCGAG Note that Link 2->3 is made of the last half of 2 plus the first half of 3. Link 3->4 CTTAAAGCTAGGCTAGGTAC(In fact, the Start and Finish vertices are treated slightly differently from the others, but this detail can safely be ignored in our schematic view of the procedure.) The length was chosen for technical reasons; in our illustration we will use 8-base strands, following Hapgood's schematization of the procedure; we will also continue with his airport-and-flight realization of the problem.
Atlanta Atl->Dal Dallas Atl->Chi Chicago Dal->Chi etc. Chi->Dal etc.
4. Encoding vertices and edges with DNA strands